|
Left Crispr |
Right Crispr |
| Crispr ID |
1133122462 |
1133122466 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:3618494-3618516
|
16:3618518-3618540
|
| Sequence |
CCAAGGCGGGCGGATTACCTCTG |
TCAGGAGTTTGAGACCAGCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 294, 3: 6523, 4: 38501} |
{0: 1836, 1: 49211, 2: 124310, 3: 181848, 4: 201665} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|