ID: 1133127872_1133127881

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1133127872 1133127881
Species Human (GRCh38) Human (GRCh38)
Location 16:3657884-3657906 16:3657914-3657936
Sequence CCCTGTGCCCACTTGCCTGCAGG CATCAGTGACCACTATCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 303} {0: 1, 1: 0, 2: 2, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!