ID: 1133156567_1133156586

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1133156567 1133156586
Species Human (GRCh38) Human (GRCh38)
Location 16:3880470-3880492 16:3880509-3880531
Sequence CCCCACCCCCCGTTCCGCCGCCG CGCCGCCGCCGCCGGGCTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 326} {0: 1, 1: 5, 2: 31, 3: 131, 4: 676}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!