|
Left Crispr |
Right Crispr |
| Crispr ID |
1133156578 |
1133156586 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:3880493-3880515
|
16:3880509-3880531
|
| Sequence |
CCGCCGCCGCTGCCGCCGCCGCC |
CGCCGCCGCCGCCGGGCTCCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 31, 1: 1156, 2: 1688, 3: 2848, 4: 5616} |
{0: 1, 1: 5, 2: 31, 3: 131, 4: 676} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|