ID: 1133169424_1133169430

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1133169424 1133169430
Species Human (GRCh38) Human (GRCh38)
Location 16:3972033-3972055 16:3972066-3972088
Sequence CCATCACACACAGCATGTGCACT GGGGGCTGCCTCGCAACAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 225} {0: 1, 1: 0, 2: 1, 3: 6, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!