ID: 1133172988_1133172997

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133172988 1133172997
Species Human (GRCh38) Human (GRCh38)
Location 16:3993168-3993190 16:3993197-3993219
Sequence CCTTTAAAGGAATCCCGCCCAGC CCTGAGCGCTGGTTTCCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 45} {0: 1, 1: 0, 2: 1, 3: 13, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!