ID: 1133184951_1133184955

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1133184951 1133184955
Species Human (GRCh38) Human (GRCh38)
Location 16:4089363-4089385 16:4089407-4089429
Sequence CCACGTTGTCACATGTATCAGAA AATCGTATGCTATCCTACAGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 37, 3: 375, 4: 1708} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!