ID: 1133184954_1133184955

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1133184954 1133184955
Species Human (GRCh38) Human (GRCh38)
Location 16:4089393-4089415 16:4089407-4089429
Sequence CCTTTTTAAGGCTGAATCGTATG AATCGTATGCTATCCTACAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 120, 3: 1154, 4: 7033} {0: 1, 1: 0, 2: 0, 3: 4, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!