ID: 1133200401_1133200410

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1133200401 1133200410
Species Human (GRCh38) Human (GRCh38)
Location 16:4200678-4200700 16:4200723-4200745
Sequence CCAATAGCTGTGCATCCACTACA TAGGCTACAAAAAATAGTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 71} {0: 1, 1: 0, 2: 0, 3: 9, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!