ID: 1133202895_1133202901

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1133202895 1133202901
Species Human (GRCh38) Human (GRCh38)
Location 16:4215293-4215315 16:4215319-4215341
Sequence CCATGCTCCTAAAGTCAAGGCTA CCACTGGGACAGCTTGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 136} {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!