ID: 1133210844_1133210849

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1133210844 1133210849
Species Human (GRCh38) Human (GRCh38)
Location 16:4262665-4262687 16:4262696-4262718
Sequence CCGCTGAGTCTCGGGGGTTAGTG GCAAGGCTGCCAGAGAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64} {0: 1, 1: 0, 2: 2, 3: 26, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!