ID: 1133212778_1133212789

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1133212778 1133212789
Species Human (GRCh38) Human (GRCh38)
Location 16:4272475-4272497 16:4272512-4272534
Sequence CCAAGGAAGGAGGGTCCCGGGGC GTGTGGGGCTGCAGCCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 314} {0: 1, 1: 0, 2: 2, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!