ID: 1133212782_1133212789

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1133212782 1133212789
Species Human (GRCh38) Human (GRCh38)
Location 16:4272490-4272512 16:4272512-4272534
Sequence CCCGGGGCGGCGCGGACCCGGCG GTGTGGGGCTGCAGCCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 291} {0: 1, 1: 0, 2: 2, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!