ID: 1133221675_1133221694

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133221675 1133221694
Species Human (GRCh38) Human (GRCh38)
Location 16:4321621-4321643 16:4321667-4321689
Sequence CCTGCCTCACTGCCCAGTTCACT GCCAGGGGCCGTGGGAACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 375} {0: 1, 1: 0, 2: 2, 3: 42, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!