ID: 1133221676_1133221694

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1133221676 1133221694
Species Human (GRCh38) Human (GRCh38)
Location 16:4321625-4321647 16:4321667-4321689
Sequence CCTCACTGCCCAGTTCACTCTGG GCCAGGGGCCGTGGGAACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 302} {0: 1, 1: 0, 2: 2, 3: 42, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!