ID: 1133234069_1133234072

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1133234069 1133234072
Species Human (GRCh38) Human (GRCh38)
Location 16:4379568-4379590 16:4379582-4379604
Sequence CCTGCTTTCTTCTGTCTGCCCTG TCTGCCCTGACGTGGCTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 730} {0: 1, 1: 0, 2: 0, 3: 25, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!