ID: 1133236216_1133236231

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1133236216 1133236231
Species Human (GRCh38) Human (GRCh38)
Location 16:4388574-4388596 16:4388626-4388648
Sequence CCCAGGTGCCCATCCATGCCAGC CGTGCTCTGCAGGAGGCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 375} {0: 1, 1: 0, 2: 2, 3: 12, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!