ID: 1133236719_1133236722

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1133236719 1133236722
Species Human (GRCh38) Human (GRCh38)
Location 16:4390788-4390810 16:4390827-4390849
Sequence CCTGCACAAGATGGACGTGAGGC GCTTGCACAAAGTCGCAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 65} {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!