ID: 1133241417_1133241432

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133241417 1133241432
Species Human (GRCh38) Human (GRCh38)
Location 16:4416421-4416443 16:4416462-4416484
Sequence CCCGAGGCGACAGCGCCCGGTCC GCGGCGGGGCGGCCGAGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82} {0: 1, 1: 1, 2: 1, 3: 36, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!