ID: 1133246807_1133246816

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1133246807 1133246816
Species Human (GRCh38) Human (GRCh38)
Location 16:4454673-4454695 16:4454710-4454732
Sequence CCCACTCTTCTTGAGGTGGCACT ACGTGGGCCCCTGGGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114} {0: 1, 1: 0, 2: 1, 3: 27, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!