|
Left Crispr |
Right Crispr |
| Crispr ID |
1133254603 |
1133254610 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4508972-4508994
|
16:4509023-4509045
|
| Sequence |
CCGCCCACCAGTGCTGCTTGCTG |
CTGCTCCAGCTCACTCTCTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 4, 3: 65, 4: 390} |
{0: 1, 1: 0, 2: 13, 3: 161, 4: 814} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|