ID: 1133256316_1133256331

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1133256316 1133256331
Species Human (GRCh38) Human (GRCh38)
Location 16:4518545-4518567 16:4518593-4518615
Sequence CCCTCACCCCTCCATATCCACAT CCCAGCAGAGACTGCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 374} {0: 1, 1: 0, 2: 2, 3: 78, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!