ID: 1133264345_1133264350

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1133264345 1133264350
Species Human (GRCh38) Human (GRCh38)
Location 16:4574562-4574584 16:4574575-4574597
Sequence CCATGGAACCCTTTCCCACTCCT TCCCACTCCTTGGGAAACACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 395} {0: 1, 1: 0, 2: 5, 3: 23, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!