ID: 1133268854_1133268868

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1133268854 1133268868
Species Human (GRCh38) Human (GRCh38)
Location 16:4600600-4600622 16:4600649-4600671
Sequence CCCAGAAAGGGTGCTGGGGCCCT GGACCCCCATGCTGACCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 251} {0: 1, 1: 0, 2: 0, 3: 13, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!