ID: 1133271707_1133271719

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1133271707 1133271719
Species Human (GRCh38) Human (GRCh38)
Location 16:4613738-4613760 16:4613782-4613804
Sequence CCAGGTAGCCTCTGGGCAGCACA ATGGGTTAGGAGAGGCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 239} {0: 1, 1: 0, 2: 1, 3: 13, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!