ID: 1133273518_1133273524

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1133273518 1133273524
Species Human (GRCh38) Human (GRCh38)
Location 16:4623397-4623419 16:4623423-4623445
Sequence CCGTACTCATTTGGCTTCCCAAG CCCTGACAAGAGGAAGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 185} {0: 1, 1: 0, 2: 1, 3: 27, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!