|
Left Crispr |
Right Crispr |
| Crispr ID |
1133277229 |
1133277244 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4646414-4646436
|
16:4646462-4646484
|
| Sequence |
CCCTGTCTCAAAAAAAAAAAAAG |
GGGCTTGCCTGGGCATGGAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 781, 1: 15625, 2: 21086, 3: 49277, 4: 165965} |
{0: 1, 1: 1, 2: 2, 3: 32, 4: 431} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|