ID: 1133280563_1133280573

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133280563 1133280573
Species Human (GRCh38) Human (GRCh38)
Location 16:4662797-4662819 16:4662838-4662860
Sequence CCTATGTGTCTGTTGGTTCTGAG GGTGCTTGGCTGCGGGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 172} {0: 1, 1: 0, 2: 0, 3: 16, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!