ID: 1133287667_1133287681

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1133287667 1133287681
Species Human (GRCh38) Human (GRCh38)
Location 16:4698120-4698142 16:4698164-4698186
Sequence CCACCTCAGACCTTCTAGGGGAG TGCAGCTGGCCCTCATGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 189} {0: 1, 1: 0, 2: 3, 3: 24, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!