ID: 1133289429_1133289433

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1133289429 1133289433
Species Human (GRCh38) Human (GRCh38)
Location 16:4709232-4709254 16:4709248-4709270
Sequence CCCTGTCTCTCCCAAAAATGCAA AATGCAAAATTAGCCAGACGTGG
Strand - +
Off-target summary {0: 2, 1: 102, 2: 5455, 3: 79857, 4: 178198} {0: 1, 1: 214, 2: 3956, 3: 12974, 4: 25838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!