ID: 1133289429_1133289439

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133289429 1133289439
Species Human (GRCh38) Human (GRCh38)
Location 16:4709232-4709254 16:4709282-4709304
Sequence CCCTGTCTCTCCCAAAAATGCAA TGTAATCCCAGCTACTAGGGAGG
Strand - +
Off-target summary {0: 2, 1: 102, 2: 5455, 3: 79857, 4: 178198} {0: 4457, 1: 105533, 2: 254011, 3: 236169, 4: 467796}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!