|
Left Crispr |
Right Crispr |
Crispr ID |
1133289429 |
1133289439 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:4709232-4709254
|
16:4709282-4709304
|
Sequence |
CCCTGTCTCTCCCAAAAATGCAA |
TGTAATCCCAGCTACTAGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 102, 2: 5455, 3: 79857, 4: 178198} |
{0: 4457, 1: 105533, 2: 254011, 3: 236169, 4: 467796} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|