ID: 1133289432_1133289437

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1133289432 1133289437
Species Human (GRCh38) Human (GRCh38)
Location 16:4709243-4709265 16:4709279-4709301
Sequence CCAAAAATGCAAAATTAGCCAGA GCCTGTAATCCCAGCTACTAGGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 289, 3: 443, 4: 909} {0: 3551, 1: 119062, 2: 256286, 3: 228049, 4: 381809}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!