|
Left Crispr |
Right Crispr |
| Crispr ID |
1133289435 |
1133289439 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4709261-4709283
|
16:4709282-4709304
|
| Sequence |
CCAGACGTGGTGGCACATGCCTG |
TGTAATCCCAGCTACTAGGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 179, 1: 4914, 2: 27317, 3: 82543, 4: 176282} |
{0: 4457, 1: 105533, 2: 254011, 3: 236169, 4: 467796} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|