ID: 1133289435_1133289445

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133289435 1133289445
Species Human (GRCh38) Human (GRCh38)
Location 16:4709261-4709283 16:4709311-4709333
Sequence CCAGACGTGGTGGCACATGCCTG CAGGAGAATCGCTTGAACCCGGG
Strand - +
Off-target summary {0: 179, 1: 4914, 2: 27317, 3: 82543, 4: 176282} {0: 41137, 1: 134699, 2: 211581, 3: 171799, 4: 128801}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!