ID: 1133300572_1133300574

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1133300572 1133300574
Species Human (GRCh38) Human (GRCh38)
Location 16:4779857-4779879 16:4779870-4779892
Sequence CCCAGGCAGGAGAGGGGAGTCCT GGGGAGTCCTATCCTTTTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 66, 4: 392} {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!