ID: 1133303823_1133303828

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1133303823 1133303828
Species Human (GRCh38) Human (GRCh38)
Location 16:4798065-4798087 16:4798094-4798116
Sequence CCTCACCTTGGTGGAGTTGGGCT CATGCAGCTGGTACACCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 128} {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!