ID: 1133314425_1133314434

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1133314425 1133314434
Species Human (GRCh38) Human (GRCh38)
Location 16:4873728-4873750 16:4873768-4873790
Sequence CCATTCCTGTTCCCATGAAAAGC CAGTCTGAGGAGATGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 491} {0: 1, 1: 1, 2: 1, 3: 31, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!