ID: 1133321788_1133321796

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1133321788 1133321796
Species Human (GRCh38) Human (GRCh38)
Location 16:4918754-4918776 16:4918787-4918809
Sequence CCCACCATCCAGCTGGCCGCAGG GTGTGCCCCTTGGAGAGCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 201} {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!