ID: 1133322590_1133322599

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1133322590 1133322599
Species Human (GRCh38) Human (GRCh38)
Location 16:4923480-4923502 16:4923495-4923517
Sequence CCAGCCATCAGCGACCTGGAAGG CTGGAAGGGGGCTCCCTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138} {0: 1, 1: 0, 2: 2, 3: 40, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!