ID: 1133331065_1133331071

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1133331065 1133331071
Species Human (GRCh38) Human (GRCh38)
Location 16:4974410-4974432 16:4974451-4974473
Sequence CCCAGGCTGGTCTTGAACGCCTG ACCTCGACCTCCCAAAGTGCTGG
Strand - +
Off-target summary {0: 81, 1: 18859, 2: 38218, 3: 57717, 4: 51393} {0: 1213, 1: 40702, 2: 183890, 3: 256421, 4: 172051}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!