|
Left Crispr |
Right Crispr |
Crispr ID |
1133331065 |
1133331071 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:4974410-4974432
|
16:4974451-4974473
|
Sequence |
CCCAGGCTGGTCTTGAACGCCTG |
ACCTCGACCTCCCAAAGTGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 81, 1: 18859, 2: 38218, 3: 57717, 4: 51393} |
{0: 1213, 1: 40702, 2: 183890, 3: 256421, 4: 172051} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|