|
Left Crispr |
Right Crispr |
Crispr ID |
1133331066 |
1133331077 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:4974411-4974433
|
16:4974461-4974483
|
Sequence |
CCAGGCTGGTCTTGAACGCCTGG |
CCCAAAGTGCTGGGATTACAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 80, 1: 18827, 2: 90316, 3: 160705, 4: 182814} |
{0: 3844, 1: 4167, 2: 2966, 3: 3317, 4: 4349} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|