|
Left Crispr |
Right Crispr |
| Crispr ID |
1133331069 |
1133331073 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4974429-4974451
|
16:4974452-4974474
|
| Sequence |
CCTGGGCTTAAGCGATTCTCCGA |
CCTCGACCTCCCAAAGTGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 30, 2: 975, 3: 14717, 4: 106371} |
{0: 3567, 1: 131954, 2: 279099, 3: 207573, 4: 119987} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|