|
Left Crispr |
Right Crispr |
| Crispr ID |
1133331070 |
1133331077 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4974448-4974470
|
16:4974461-4974483
|
| Sequence |
CCGACCTCGACCTCCCAAAGTGC |
CCCAAAGTGCTGGGATTACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1283, 1: 42676, 2: 192034, 3: 269723, 4: 180375} |
{0: 3844, 1: 4167, 2: 2966, 3: 3317, 4: 4349} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|