|
Left Crispr |
Right Crispr |
Crispr ID |
1133331072 |
1133331079 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:4974452-4974474
|
16:4974478-4974500
|
Sequence |
CCTCGACCTCCCAAAGTGCTGGG |
ACAGGGTGAGCCACCGTGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 3341, 1: 124982, 2: 268208, 3: 211109, 4: 126311} |
{0: 18, 1: 127, 2: 457, 3: 2088, 4: 25629} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|