|
Left Crispr |
Right Crispr |
| Crispr ID |
1133331076 |
1133331079 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4974461-4974483
|
16:4974478-4974500
|
| Sequence |
CCCAAAGTGCTGGGATTACAGGG |
ACAGGGTGAGCCACCGTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3574, 1: 298705, 2: 273637, 3: 155315, 4: 139595} |
{0: 18, 1: 127, 2: 457, 3: 2088, 4: 25629} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|