ID: 1133337515_1133337527

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133337515 1133337527
Species Human (GRCh38) Human (GRCh38)
Location 16:5015608-5015630 16:5015654-5015676
Sequence CCTGCTCTCAAAAGCACTAGTGG CCCCCTAAGAAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103} {0: 1, 1: 0, 2: 1, 3: 18, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!