ID: 1133339437_1133339445

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133339437 1133339445
Species Human (GRCh38) Human (GRCh38)
Location 16:5027160-5027182 16:5027210-5027232
Sequence CCCTCAGGGTGGCTTCAGGTGGC CAGAGACAGGCTGAAGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 182} {0: 1, 1: 1, 2: 1, 3: 56, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!