ID: 1133344394_1133344405

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1133344394 1133344405
Species Human (GRCh38) Human (GRCh38)
Location 16:5060286-5060308 16:5060338-5060360
Sequence CCGGTTCCCAGCAGCTGCACCAG AGTCCTGGGGCCCGAACGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 392} {0: 1, 1: 0, 2: 1, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!