ID: 1133344424_1133344427

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1133344424 1133344427
Species Human (GRCh38) Human (GRCh38)
Location 16:5060411-5060433 16:5060426-5060448
Sequence CCCGGGCTGGAGGGTCAGCTGGA CAGCTGGAACTCTGGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 453} {0: 1, 1: 0, 2: 5, 3: 31, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!