ID: 1133346143_1133346145

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1133346143 1133346145
Species Human (GRCh38) Human (GRCh38)
Location 16:5071857-5071879 16:5071888-5071910
Sequence CCTCATGCTTGGTCCTGCTGGCG GCTGCTGCCGCTGCTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111} {0: 4, 1: 112, 2: 246, 3: 611, 4: 1666}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!